Business Information Learning

  1. Trang chủ
  2. Lưu
  3. Thẻ
  4. Hỏi - Đáp

 
 
Trang chủ
BIL'log, ⌚ 2022-02-27
***
☕ Nhàn đàm ICT: RT-PCR (Reverse Transcription Polymerase Chain Reaction) 🧬
Tác giả: Lê Văn Lợi
Bài đã đăng trên diễn đàn ICT_VN (ict_vn@googlegroups.com).
Ngày đăng: 27-02-2022.

Để giúp anh/chị quyết định có đọc tiếp hay không, tôi xin phép cung cấp các thông tin liên quan đến bài post này như sau:

  • Chủ đề: Bioinformatics, DNA
  • Tính thời sự: tháng 6/2020
  • Thời gian đọc: 8 phút, không tính thời gian uống cà phê

~

Hôm nay, xin phép cùng anh/chị đàm luận về RT-PCR, là viết tắt của cụm từ Reverse Transcription Polymerase Chain Reaction - mà tôi tạm dịch là “Phiên mã Ngược Chuỗi Phản ứng Polymerase”. Nghe có vẻ bí hiểm quá đúng không ạ?!

Cũng xin lưu ý thêm với anh/chị tôi là dân “ngoại đạo” về y sinh, nhưng vì bản tính tò mò mà tìm hiểu rồi post lên đây phục vụ anh/chị nhâm nhi cà phê. Anh/chị thấy chỗ nào đó chưa chính xác hoặc quá ngô nghê về lĩnh vực y sinh thì cũng mong anh/chị cho qua! 😊

☕ Số là thế này: trong đại dịch Covid-19, một trong những vấn đề đặt ra là test (xét nghiệm) phát hiện người bị mắc SARS-CoV-2 (SARS-CoV-2 là tên của virus đã gây ra đại dịch COVID-19). Khi hỏi Google thì tôi được địa chỉ đáng tin cậy là trang này của WHO (Tổ chức Y tế Thế giới). Để giúp anh/chị tiết kiệm thời gian, tôi xin tóm tắt nội dung. Có 3 cách làm xét nghiệm:

  1. Phát hiện gen của virus trong bệnh phẩm,
  2. Phát hiện kháng nguyên (antigen) trong bệnh phẩm,
  3. Phát hiện kháng thể (antibody) trong cơ thể bệnh nhân.

Chúng ta bỏ qua giải pháp số 3 (thường là bằng xét nghiệm huyết thanh) vì không liên quan gì đến ICT cả!

Đại ý của giải pháp số 2 (giải pháp này còn có tên gọi là xét nghiệm nhanh):

  • Kháng nguyên (antigen) là gì? Cơ thể người (và các động vật có xương sống) có hệ thống miễn dịch. Nguyên tắc hoạt động của hệ thống này khá đơn giản (😊): khi thấy một protein lạ (protein lạ là gì? Là protein có mã không do gen của cơ thể đó sinh ra) thì hệ miễn dịch báo động cần bắt giữ và tiêu diệt. Lúc này, các tế bào bạch cầu, cụ thể là tế bào B, sẽ tạo ra các kháng thể để bẫy và tiêu diệt các protein lạ này. Kháng thể là protein có cấu trúc hình chữ Y sử dụng cánh tay của chúng làm cơ cấu bám lấy các protein lạ tạo thành một lớp vỏ bọc. Protein lạ này được đặt tên là kháng nguyên (anti-gen) vì nó kích hoạt tạo ra các kháng thể.
  • Nguyên lý của test nhanh (xét nghiệm nhanh)? Khá đơn giản (😊): người ta lấy các kháng thể từ động vật để vào một phiến kính và test xem chúng có bám vào “protein lạ” như ở trên hay không. Cách thực hiện (chắc nhiều người trên diễn đàn này đã có cơ hội trải nghiệm):
    • Lấy mẫu chất nhầy từ cổ họng hoặc mũi bằng tăm bông. Sau đó, nhúng tăm bông vào chất lỏng để hòa tan chất nhầy và giải phóng virus.
    • Sau đó, nhỏ khoảng 2, 3 giọt chất lỏng này lên bề mặt của phiến kính (phiến kính đã được phủ bằng kháng thể lấy từ động vật). Các kháng thể này bị dính vào phiến kính và “bám vào” bất kỳ protein nào của coronavirus có trong mẫu.
    • Sau đó, một hỗn hợp kháng thể thứ hai được bôi lên phiến kính. Các kháng thể này đã được biến đổi về mặt hóa học bằng một loại thuốc nhuộm màu giúp chúng có thể nhìn thấy bằng mắt thường.
    • Nếu mẫu có chứa các protein kháng nguyên virus, thì các kháng nguyên đó bây giờ được kẹp bởi hai kháng thể: một kháng thể gắn chúng vào bộ xét nghiệm và một kháng thể khác làm cho chúng ta có thể nhìn thấy được. Càng có nhiều kháng nguyên coronavirus, thuốc nhuộm màu sẽ càng hiện rõ, chứng tỏ bệnh nhân đã nhiễm SARS-CoV-2.
    • Nếu không có màu, điều này có nghĩa là người đó không có SARS-CoV-2 hoặc mẫu không có đủ protein virus.

Xét nghiệm nhanh có các ưu điểm nổi bật: cách làm đơn giản (ai cũng làm được), cho kết quả nhanh (15 đến 30 phút) và rẻ tiền.

Để xét nghiệm nhanh có kết quả chính xác thì mẫu bệnh phẩm cần có ít nhất hàng ngàn protein chứa virus. Nếu không đủ con số này thì kết quả chưa chính xác, người ta gọi là âm tính giả (false negative) – tức là kết quả xét nghiệm nói là bệnh nhân không bị nhiễm nhưng trên thực tế ngược lại: bệnh nhân đã bị nhiễm (mới bị nhiễm), số protein chứa coronavirus hãy còn ít.

Đối với các anh/chị trong ngành điện, điện tử đã từng sử dụng oscilloscope (máy hiện sóng) để xem tín hiệu xung thì trường hợp âm tính giả (false negative) tương tự như chúng ta quan sát một tín hiệu quá yếu nên khó phát hiện. Giải pháp thông thường cho trường hợp này là khuếch đại tín hiệu. Và câu hỏi đặt ra là: liệu khi làm xét nghiệm như trên, người ta có cách gì để “khuếch đại” số lượng coronavirus không? Câu trả lời: Có 💡, anh/chị ạ. Nhưng khuếch đại bằng cách nào? Để khuếch đại tín hiệu trên máy hiện sóng, anh/chị đôi khi chỉ cần xoay một núm nào đó. Khuếch đại số lượng coronavirus không đơn giản như vậy.

Đó chính là lúc chúng ta quay lại giải pháp số 1 - phát hiện gen của virus trong bệnh phẩm - là chủ đề chính của bài viết này (vào đề hơi dài 😊). Lại nữa, trước khi vào chủ đề chính, tôi đành phải chép lại phần giới thiệu về DNA, virus – vì đây là kiến thức nền để hiểu giải pháp. Đoạn sao chép này tôi đã giới thiệu vào một email đã đăng trên diễn đàn này vào ngày 10/01/2021 (hơn 1 năm rồi). Nếu anh/chị nào đã biết rồi thì vui lòng bỏ qua mục tiếp theo đây.

🧬

 

Viruses. Để chống lại và phòng ngừa virus, chúng ta dành ra ít phút để tìm hiểu về cơ chế của virus.

Mã hóa thông tin sự sống. Nếu như trong máy tính, chúng ta mã hóa thông tin thành các bit 0, 1 thì sự sống mã hóa thành 4 nucleotide cơ sở: A, C, G, U/T.

A: Adenine
C: Cytosine
G: Guanine
T: Thymine
U: Uracil

Trong RNA chúng ta viết các ký hiệu là A, C, G, U. 
Trong DNA chúng ta viết các ký hiệu là A, C, G, T.
-
➡ RNA của vi khuẩn có chiều dài khoảng hơn vài triệu nucleotide.
➡ DNA của cơ thể sống bậc cao có chiều dài tới hàng tỷ nucleotide.
➡ DNA của người có chiều dài khoảng 750megabyte, gồm nhiều đoạn mã lặp. Nếu có thuật toán nén tốt thì khối thông tin này sẽ được nén nhỏ xuống còn vài chục megabyte! 😊
-
Khác với các bit máy tính không có trọng lượng, các bit nucleotide có trọng lượng anh/chị nhé: 0.53 * 10⁻²¹ gram. Chẳng hạn, 1 liều vắc-xin 30 microgram chứa 6*10¹⁶ ký tự! Tính theo đơn vị byte thì lọ này chứa khoảng 25 petabyte.
 

A-xít a-min (Amino acids). Chỉ có 20 loại a-xít a-min. A-xít a-min được mã hóa theo nhóm 3 nucleotide một, được gọi là một codon. Ví dụ về cách viết codon: ‘AAC’, ‘CCG’. Một byte có 8 bit, còn một codon có 3 nucleotide. Mỗi một bit nucleotide có 4 giá trị khác nhau (A, C, G, U). Như vậy, nếu tính tổ hợp thì 3 nucleotide sẽ tạo ra 4*4*4 = 64 tổ hợp khác nhau. (Một byte có 28 = 256 tổ hợp khác nhau.)

⚠ Một codon tương ứng với một a-xít a-min. Vì chỉ có 20 loại a-xít a-min mà lại có 64 tổ hợp codon nên có nhiều codon tương ứng với cùng một loại a-xit amin. (Tham chiếu: DNA and RNA codon tables.)

Các a-xít a-min có thể được liên kết với nhau để tạo thành protein (đạm).
 

RNA. Chuyển sang thuật ngữ máy tính, DNA có thể xem như bộ nhớ trên đĩa còn RNA đóng vai là bộ nhớ RAM. Cơ thể sống có một cơ chế “chép” thông tin từ DNA sang các phân tử RNA. Giống như trong máy tính chúng ta đọc file trên đĩa (DNA) và kết quả đọc được chép vào RAM (RNA). Chúng ta có thể hiểu nôm na là “máy tính sự sống” xử lý chương trình chạy trên RNA. “Bộ nhớ RAM” RNA chứa mã nguồn có thể xử lý được (executable). Cũng giống như RAM, RNA rất mong manh (volatile) trong lúc DNA rất ổn định. (Trong máy tính, khi ta ngắt điện thì bộ nhớ RAM mất toàn bộ nội dung - trong lúc nội dung trên đĩa vẫn giữ nguyên.)

Tế bào có một cỗ máy (được gọi là ribosome) có thể phiên mã (translate) các phân tử RNA thành chuỗi a-xít a-min (protein). Ribosome đọc mã trong sợi RNA và căn cứ vào mã đọc được để “sản xuất” ra a-xít a-min. Có thể nói ribosome là “nhà máy tổng hợp protein bên trong tế bào”.
 

Protein. Protein là các phân tử có kích cỡ từ nhỏ đến rất lớn có thể thực hiện (hoặc kích hoạt) hầu hết mọi phản ứng hóa học, quá trình vật lý.

➡ Có loại protein chỉ có ý nghĩa “quản trị nội bộ”. Chẳng hạn như insulin báo hiệu rằng các tế bào nên thay đổi hành vi của chúng, nhưng chính bản thân insulin lại không làm hoặc tạo ra bất cứ điều gì.

➡ Có loại protein đóng vai trò cảm biến, như protein cryptochrome có thể phát hiện ánh sáng, từ trường. Có loại khác đo được mức pH, đo nhiệt độ, đo mức đường glucose!

➡ Có loại protein là men (enzyme) xúc tác phản ứng hóa học để sản sinh ra các phân tử mới.

➡ Có loại protein chỉ đóng vai “cấu trúc” cho tế bào và các hợp phần của tế bào.

Tóm lại, protein là các thành tố cơ bản của sự sống, vừa có chức năng cảm biến, vừa có chức năng thực thi.
 

Tương tác (interaction). Tất nhiên, mọi thành tố của cơ thể sống tương tác với nhau.

➡ Có loại protein “chặn” không cho đọc thông tin một khối nào đó của DNA.

➡ Có loại protein “đọc” thông tin DNA chuyển sang RNA và trên cơ sở đó, ribosome sản sinh ra các protein mới.
 

Phiên mã (transcription). Phiên mã (sao chép mã) là bước đầu tiên của một số bước biểu hiện gen dựa trên DNA, trong đó một đoạn DNA cụ thể được sao chép thành RNA (đặc biệt là mRNA) bởi enzyme RNA polymerase. Tham khảo: Transcription.

Điểm mấu chốt chúng ta cần quan tâm ở đây là “phần mềm sự sống” (life software) có thể chép một đoạn DNA thành RNA.

 

Virus. Virus có RNA và DNA là vật liệu di truyền của chúng. Nhưng virus không có cỗ máy ribosome.

⚠ Nếu protein bao bọc phần mềm virus lây nhiễm vào tế bào, thì DNA (hoặc RNA) của chính nó sẽ chạy trên bộ máy của tế bào sống đó. Nếu thành công, cơ chế này sẽ biến tế bào thành một nhà máy sản xuất virus mới, khi được thoát ra, chúng có thể tiếp tục lây nhiễm sang các tế bào khác.

⚠ Virus không phải là một cơ thể sống, nó là một “phần mềm” “chạy” trên một cơ thể sống.

🧬

 

DNA. Bây giờ chúng ta chuyển sang tìm hiểu cấu trúc đặc biệt của DNA. DNA là chuỗi kép sợi dây xoắn. Mỗi một sợi được tạo thành từ chuỗi các “bit” (nucleotide) A, C, G, T. Điểm đặc biệt là hai sợi này không độc lập. Nếu một sợi có bit A thì sợi kia tương ứng sẽ là bit T (và ngược lại). Nếu một sợi có bit C thì sợi kia tương ứng sẽ là bit G (và ngược lại). Các bit được “đọc” theo hai chiều ngược nhau. Để cho dễ hiểu, tôi lấy một ví dụ về sợi DNA:

<-------
 ACGTTCA
 |||||||
 TGCAAGT
 ------->

Trong ví dụ trên, mỗi một A đều có đối diện là T và mỗi một C đều có đối diện là G. Cấu trúc này được gọi là redundant (dư thừa). Nghĩa là khi ta biết một sợi thì ta dễ dàng suy ra sợi kia. Chính nhờ tính chất redundant này mà DNA có thể “tự sửa chữa” nếu một số bít bị hỏng như ví dụ dưới đây.

<-------               <-------
 ACG TCA                ACGTTCA
 |||||||      -->       |||||||
 T CAAGT                TGCAAGT
 ------->               ------->

         Qui trình sửa chữa

-

Cơ chế “tự sửa chữa” này của DNA cho phép DNA sao chép “nhân bản”. Một cách giản lược, cơ chế sao chép được thực hiện như sau:

  1. Hai sợi DNA tách rời nhau (bước này có tên gọi là ‘denatured’ – tạm dịch là biến tính)
  2. Các nucleotide mới tự điền vào chỗ bị khuyết (các ô màu vàng trong ví dụ ở trên)
  3. Hai phân tử DNA polymerise (chập lại)

Một ví dụ về nhân đôi DNA: (nguồn: https://berthub.eu/articles/posts/dna-grep-2019-ncov/)

           1                              2      &      3        

                 <-------          <-------             <-------

                  ACGTTCA           ACGTTCA              ACGTTCA
              ^   |||||||    -->    |||||||     -->      |||||||
                                   TGCA                 TGCAGGT
<-------   ↗                         --->                 ------->
 ACGTTCA ↗                                                Xong!
 |||||||                                                 
 TGCAAGT                                              Hai bản sao!
 ------->                             <---             <-------
                                      TTCA              ACGTTCA
                 |||||||    -->    |||||||     -->      |||||||
                v TGCAAGT           TGCAAGT              TGCAAGT
                  ------->          ------->             ------->

Toàn bộ quy trình sao chép này có tên gọi là “polymerase reaction” – tạm dịch là phản ứng polymerase. Trong ví dụ trên, từ duy nhất một DNA, mỗi lần thực hiện phản ứng polymerase chúng ta được gấp đôi số DNA: 1, 2, 4, 8, … Đây chính là ý tưởng 💡 khuếch đại DNA của virus trong bệnh phẩm của giải pháp số 1. Nghĩa là, bằng cách áp dụng phản ứng polymerase nhiều lần, chúng ta dễ dàng phát hiện ra bệnh phẩm có chứa coronavirus dù bệnh phẩm chỉ có rất ít mầm bệnh! Như vậy, phản ứng polymerase là chìa khóa vấn đề.

🧬

 

Polymerase chain reaction (Phản ứng chuỗi polymerase hay còn gọi là phản ứng chuỗi trùng hợp).

Trên thực tế, DNA không tự nhân đôi một cách ngẫu hứng như thế. Xin mời anh/chị quan sát hai ví dụ sau.

Ví dụ 1: Polymerase thực hiện được:

<-------           <-------
 ACGTTCA            ACGTTCA
 |||||||    ->      |||||||
 TGCA               TGCAGGT 
 --->               ------->

 

Ví dụ 2: Polymerase không thực hiện được:

<-------           <-------
 ACGTTCA            ACGTTCA
 |||||||    ->      |||||||
                    TGCAGGT
                    ------->

-

Nói một cách khác, polymerase không thể hoạt động trên một sợi đơn lẻ. Muốn thực hiện được phản ứng polymerase người ta cần một Primer. Nhiều tài liệu dịch Primer là “đoạn mồi”. Ví dụ trong thực tế: khi chúng ta muốn đốt một cái gì đó, chúng ta cần một mồi lửa. Chuỗi phản ứng polymerase cũng tương tự như vậy: muốn có phản ứng polymerase, chúng ta cần một “mồi”. Tóm lại, Primer là gì vậy? Đơn giản đó là một đoạn mã khớp với một đoạn “bù” của một sợi DNA. Chúng ta lấy lại Ví dụ 1.

<-------                      <-------            <-------
 ACGTTCA                       ACGTTCA             ACGTTCA
 |||||||    + TGCA     -->     |||||||    -->      |||||||
              ---->            TGCA                TGCAGGT
                               ---->               ------->
             Primer                     Phản ứng
                                        polymerase

 

Trong Ví dụ 1, Primer chính là đoạn TGCA. Chú ý rằng đoạn Primer (nằm ở sợi dưới trong Ví dụ 1) phải có các bit bù tương ứng với đoạn ở sợi trên: ACGT (các cặp T↔A, C↔G “hút nhau”). Như vậy, Primer không thể là đoạn mã bất kỳ. Đoạn mã của Primer phải khớp (bù) với ít nhất một đoạn mã trong sợi DNA đối diện. Nếu chúng ta ký hiệu hàm pattern = complement (Primer) là đoạn mã khớp bù của Primer thì mẫu (pattern) phải được tìm thấy trong sợi đối diện. Nghĩa là mã sợi đối diện phải chứa đoạn mã pattern.

🧬

 

Thiết kế Primer. Vấn đề bây giờ là thiết kế Primer. Như đã được phân tích ở trên, tiêu chí số 1 là đoạn mã khớp bù phải được chứa trong mã của sợi DNA đối diện. Việc này khá đơn giản. Thách thức là ở chỗ: đoạn mã khớp bù đó, ngoài việc tìm thấy trong SARS-CoV-2, thì không được phép tìm thấy trong bất cứ gen của bất kỳ một sinh vật nào khác. Vì sao vậy? Vì nếu không, khi làm nhân bản, chúng ta có thể nhân bản (nhầm) gen của một sinh vật nào đó chứ không phải gen của SARS-CoV-2. Như vậy, không phải ai cũng có thể “sản xuất” ra được đoạn mã Primer, dù đã biết gen đầy đủ của SARS-CoV-2.

Câu hỏi tiếp theo là: đoạn mã Primer có độ dài bao nhiêu là đủ phân biệt gen của một loài với tất cả các loài còn lại. Trả lời: khoảng 20 bit DNA. Chúng ta đã biết bit DNA là hệ cơ số 4 (T, A, C, G), như vậy 20 bit cho kết quả là 4^20 = (2^20) * (2^20) ⪞ 1.000.000.000.000 (hơn một nghìn tỷ) tổ hợp khác nhau. Tất nhiên chúng ta có thể thiết kế Primer nhiều hơn 20 bit. Tuy nhiên, người ta thường tối ưu hóa Primer: nghĩa là thiết kế Primer sao cho có thể nhận dạng được gen của virus nhưng lại có số bít ít nhất. Xin giới thiệu với anh/chị một địa chỉ thiết kế Primer tối ưu: Optimum Primer For Every PCR & qPCR Assay.

Trong thực tế, để chắc chắn, người ta sử dụng nhiều Primer (nói đúng hơn nhiều cặp Primer – xem mục ⓕ.) để phát hiện ra virus, kể cả các biến thể (mutated) của nó.

🧬

 

Nhân bản DNA. Để thực hiện nhân bản, người ta cần các thành phần sau:

  1. DNA cần nhân bản (thường nghi chứa trong bệnh phẩm)
  2. Primer (xem ở trên)
  3. Hỗ hợp Nucleotide (tham khảo ở đây)
  4. Vi khuẩn kích hoạt polymerase (tham khảo ở đây)
  5. Một số hợp chất dinh dưỡng khác

Người ta để các hợp chất trên vào trong một ống nghiệm. Quá trinh nhân bản được thực hiện theo các bước sau:

  1. Tách 2 sợi DNA bằng cách nung ống nghiệm lên nhiệt độ khoảng 95°C và giữ mức nhiệt này trong 2 phút. Ở nhiệt độ này, trong ống nghiệm các DNA bị tách ra thành các sợi DNA đơn lẻ.
  2. Tiếp theo, người ta hạ nhiệt độ của ống nghiệm xuống khoảng 50-60°C. Trong khoảng nhiệt độ này, trong 15 giây, các Primer bắt đầu quá trình tìm (search) và khớp với đoạn mã của sợi DNA đối diện (tham khảo Ví dụ 1 ở trên).
  3. Tiếp theo, người ta đưa nhiệt độ ống nghiệm lên 68°C. Đây là mức nhiệt độ tối ưu để vi khuẩn kích hoạt quá trình Polymerase. Đây chính là quá trình “sao chép” lan tỏa từ Primer để kết thành sợi DNA khớp với sợi đối diện. Nghĩa là từ một sợi đơn DNA + Primer => thu được một DNA hoàn chỉnh (hai sợi đơn xoắn). Thời gian thực hiện: khoảng 15 giây (đối với các DNA có mã dài thì cần nhiều thời gian hơn).

Quá trình trên được lặp lại khoảng vài chục lần. Kết quả là:

  • Nếu bệnh phẩm có chứa DNA của virus thì ống nghiệm chứa rất nhiều DNA của chúng
  • Nếu bệnh phẩm không có virus thì chẳng có phản ứng Polymerase nào xảy ra cả.

Vấn đề còn lại là làm thế nào để biết DNA của virus được nhân lên? Cách thông thường hiện nay là dùng kỹ thuật nhuộm màu DNA: sử dụng một loại phân tử đặc biệt: hễ các phân tử loại này gắn với DNA của virus thì chúng “hiện màu”. Người ta dùng các camera số để khẳng định là hỗn hợp trong ống nghiệm có hiện màu hay không.

-

Về cơ bản, tôi hy vọng anh/chị đã hiểu cách người ta nhân bản số DNA (nếu có) trong bệnh phẩm. So với xét nghiệm nhanh, cách xét nghiệm này mất nhiều thời gian hơn (từ 1 ngày đến 5 ngày) và cần phòng lab với các công cụ hiện đại mới thực hiện được.

🧬

 

Một vài chi tiết kỹ thuật. Bài post của tôi đã kết thúc. Phần này tôi xin nói thêm một vài chi tiết kỹ thuật, ngoài các nguyên tắc chính đã đàm luận ở trên.

Thứ nhất, trên thực tế, để thực hiện nhân đôi DNA, người ta dùng một cặp Primer. Lý do: chúng ta biết DNA gồm 2 sợi xoắn. Và mỗi một sợi xoắn có “hướng” (direction) ngược với sợi xoắn còn lại. Mỗi một Primer chỉ dùng để Polymerase một trong hai sợi xoắn đó. Để cho trực quan, chúng ta phân biệt 2 sợi xoắn này bằng cách gọi sợi xoắn trên (có hướng từ phải sang trái) và sợi xoắn dưới (có hướng từ trái sang phải). Rõ ràng, Primer cho sợi xoắn trên không thể áp dụng cho sợi xoắn dưới, do tính chất bù nhau của các bit DNA: T↔A, C↔G. Vì vậy, chúng ta cần một cặp Primer một cho sợi xoắn trên và một cho sợi xoắn dưới.

Trong phản ứng chuỗi Polymerase, tại bước b) Primer cho sợi trên và sợi dưới tự động khớp với từng sợi DNA tương ứng. Đến khi hoàn thành bước c) thì DNA ban đầu đã được nhân đôi. Hãy lấy một ví dụ.

 

Từ DNA ban đầu:

      <------------------------------------------------------------------------

Trên:  GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Dưới:  CTGGGGTTTTAGTCGCTTTACGTGGGGCGTAATGCAAACCACCTGGGAGTCTAAGTTGACCGTCATTGGTCT

       ------------------------------------------------------------------------>

 

Và cặp Primer tương ứng là:

Primer trên: GTCTAAGTTGACCGTCATTGGTCT

 

Primer dưới: GACCCCAAAATCAGCGAAAT

 

 

Sau bước a) chúng ta tách được thành 2 sợi:

      <------------------------------------------------------------------------

Trên:  GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

 

 

Dưới:  CTGGGGTTTTAGTCGCTTTACGTGGGGCGTAATGCAAACCACCTGGGAGTCTAAGTTGACCGTCATTGGTCT

       ------------------------------------------------------------------------>

 

Đến bước b) chúng ta được (các Primer khớp với các sợi):

      <------------------------------------------------------------------------

Trên:  GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

                                                       GTCTAAGTTGACCGTCATTGGTCT

 

 

       

       GACCCCAAAATCAGCGAAAT                                                   

Dưới:  CTGGGGTTTTAGTCGCTTTACGTGGGGCGTAATGCAAACCACCTGGGAGTCTAAGTTGACCGTCATTGGTCT

       ------------------------------------------------------------------------>

 

Sau bước c) chúng ta được (DNA đã được nhân đôi nhờ phản ứng Polymerase cho cả sợi DNA trên và sợi DNA dưới):

      <------------------------------------------------------------------------

Trên:  GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Dưới:  CTGGGGTTTTAGTCGCTTTACGTGGGGCGTAATGCAAACCACCTGGGAGTCTAAGTTGACCGTCATTGGTCT

       ------------------------------------------------------------------------>

 

 

      <------------------------------------------------------------------------

Trên:  GACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGA

       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Dưới:  CTGGGGTTTTAGTCGCTTTACGTGGGGCGTAATGCAAACCACCTGGGAGTCTAAGTTGACCGTCATTGGTCT

       ------------------------------------------------------------------------>

 

Một điểm nữa tôi cũng cần làm rõ. Từ đầu bài post, chúng ta đề cập đến xét nghiệm theo phương án 1 là chuỗi phản ứng PCR áp dụng cho DNA - trong lúc gen của virus SARS-CoV-2 lại là RNA. Có sự nhầm lẫn nào chăng? Thưa anh/chị, rất may là không. Trong tự nhiên có một loại enzyme có tên là “reverse transcriptase” (dịch nghĩa là sao chép ngược) và khi trộn enzyme này với RNA thì người ta được DNA. Đơn giản là vậy. 😊

 

(_/)
( •_•)
/ >☕

 

PS. Nói thêm về viết tắt RT-PCR. Trong bài post này, RT-PCR là viết tắt của Reverse Transcription Polymerase Chain Reaction. Trên truyền thông chúng ta vẫn thường nghe Real-Time PCR và cũng được viết tắt là RT-PCR. Nếu chúng ta tham khảo bài này, để tránh nhầm lẫn, họ viết tắt Real-Time Polymerase Chain Reaction thành qPCR! 😊